Mouse p27 PCR Genotyping Using Gitschier Buffer

Posted on June 28th, 2016 by UNM CC

(PCR Recipe: Kogan et al, New Engl J Med 317: 985-990)

Primer Sequences

p27KO mice. JAX Stock 2781 (C57BL/6), JAX Stock 3122 (129S4) Fero ML, et al. Cell. (1996) 85:733-44
KO (knockout allele; Contains Neo)
Neo-1 (CCTTCTATCGCCTTCTTG)
K-3 (TGGAACCCTGTGCCATCTCTAT)
Size: KO(-) = 0.5 kB

WT (wildtype allele)
K-3 (above)
K-5 (GAGCAGACGCCCAAGAAGC)
Size: WT(+) = 1 kB

p27LoxP mice: Cre-inducible knockout (Chien WM, et al. PNAS (2006) 103:4122-7)
WT or L+ (exon 1 and 2 flanked by LoxP)
K-52 (TAGGGGAAATGGATAGTAGATGTTAGGACC)
K-53 (GGTATAATACGGAAAGTGACTCTAATGGCC)
Sizes: WT(+) = 500 bp, (L+) = 550 bp

L- (null allele, minus exons 1 and 2, residual LoxP, no Neo)
K-53 (GGTATAATACGGAAAGTGACTCTAATGGCC)
K-57 (AGCGGCTCCCGGCGCCGAGAC)
Size: (L-) 250 bp

p27STOP: Cre-inducible knock-on mice (Chien WM, et al. PNAS (2006) 103:4122-7)
WT and S+ (induced wildtype; contains residual LoxP site)
K-55 (CGCCTGGCTCTGCTCCATTTGAC)
K-56 (GACACTCTCACGTTTGACATCTTCC)
Sizes: WT(+) = 192 bp, (S+) = 240 bp

S- (Uninduced null allele; contains Lox-Stop-Lox)
K-55 (CGCCTGGCTCTGCTCCATTTGAC)
Neo-5 (CTACCCGCTTCCATTGCTCAG)
Size: (S-) = 431 bp

Buffer Recipes

Stock Solutions
1 M Tris pH 8.8 (do not use pH meter, store at room temp.)
1.23 g Tris HCl
5.13 g Tris base
q.s. 50 mL with H2O

KG-1 (10x)
8.3 mL 1M (NH4)2SO4 [10x = 166mM]
33.5 mL 1M Tris base pH 8.8 [670 mM]
174 µL ß-Mercaptoethanol [50 mM]
3.35 mL 1M MgCl2 [67 mM]
q.s. to 50 mL with H2O, and aliquot into 1.5 mL Eppendorf tubes
Store Frozen

KG-2 (10x)
25 µL of 100mM dNTP Stocks (x4) [@10 mM]
25 µL DMSO [10%]
25 µL 8 mg/mL BSA [0.8 mg/mL]
150 µL H2O (makes 250 µL total vol.)
Store frozen
PCR Master Mix (Multiply volumes x # of PCR reactions, below)
2 µL KG-1 (10x) [1x final]
2 µL KG-2 (10x) [1x]
2 µL Primer 1 (1uM) [0.1 mM]
2 µL Primer 2 (1uM) [0.1 mM]
0.2 µL Taq (Gibco) (5 U/uL) [0.05 U/mL]
10.8 µL H2O (subtotal 19 µL)
Aliquot into PCR tubes (19 µL each)
Add 1 µL sample DNA to each tube (20 µL total vol.)

Cycling Parameters

Do not place the tubes on the machine until the block has heated to > 90ºC. The first 4 cycles use a higher melting temperature to help denature long genomic DNA. Subsequent cycles use a lower melt temp, which is sufficient to denature shorter PCR products and preserves enzyme function. Longer (2 min.) extension times should be used if products > 2 kb are being amplified.
95°C hold x 2 min. (insert tubes at > 90ºC)
(96°C x 30", 57°C x 30", 65°C x 1-2') x4
(93°C x 30", 57°C x 30", 65°C x 1-2') x36
4°C hold

Run products on a 0.8-1.2% agarose gel

Tags: Fero-Mice

You must be logged-in to the site to post a comment.