Fero-Lab-Protocols

August 1, 2016

Immunohistochemistry (IHC) of Thymus Frozen Sections

By UNM CCC UNM CCC

(courtesy of Farr lab, UWMC) Materials Cold Acetone (-20ºC) in Coplin jars PBS, BenchKote paper, plastic lids Anti-digoxigenin-HRP diluent: 1% BSA in PBS (store 10 mL aliquots of BSA at -20ºC) Anti-rat-digoxigenin diluent: 5% Milk powder, 10% mouse serum, 10% goat serum, 1% BSA in PBS Primary and secondary antibodies (this had a link that […]

View full entry

Tags: Fero-Histology


August 1, 2016

X-gal Staining Procedure

By UNM CCC UNM CCC

M. Fero — 3/24/04 — adapted from P. Soriano Materials Fixative 2% Paraformaldehyde (in PBS) Staining solution 5 mM potassium ferricyanide, 5 mM potassium ferrocyanide, 2 mM MgCI, 0.01% sodium deoxycholate 0.02% Nonidet P-40 (NP-40) in PBS. X-gal Stock 40 mg/mL X-Gal (5 -Bromo-4-chloro-3-indolyl-beta-D-galactopyranoside) in dimethylformamide store at -20°C in small aliquots. X-gal Mix (make […]

View full entry

Tags: Fero-Histology


July 15, 2016

BrdU-Immunoperoxidase Staining of Paraffin Tissue Sections

By UNM CCC UNM CCC

M. Fero Materials Syringes, 1 mL with 36G needles BrdU: 3-10 mg/mL in PBS Fixative: Methyl Carnoy’s, or 4% paraformaldehyde in PBS Paraffin processing materials Organic solvents: Xylene, EtOH, MeOH 0.3% H2O2: 2 mL 30% H2O2 in 200 mL MeOH Trypsin: Dilute (10x stock, -20ºC) 1/5 in PBS 2.5 N HCl: Dilute concentrated HCl 1/22 […]

View full entry

Tags: Fero-Histology


July 15, 2016

Gill’s Hematoxylin Solution

By UNM CCC UNM CCC

Ingredient 1x Function Ethylene glycol  250 ml solvent Distilled water  750 ml solvent Hematoxylin 2 g dye Sodium iodate 0.2 g oxidizer Aluminum sulphate 20 g mordant Glacial acetic acid 20 ml acidifier Procedure Dissolve ethylene glycol in distilled water. Add hematoxylin, then sodium iodate. Add aluminum sulphate and acetic acid Stir for 1 hour […]

View full entry


July 15, 2016

Hematoxylin and Eosin (H&E) Staining

By UNM CCC UNM CCC

(M. Fero, courtesy of the Porter lab) Revised 2/07 Also see Wei-Ming and Emily’s protocol  This reference link is broken. Reagents Stains (change after every 3rd use) Harris hematoxylin: 1X stock. Anatech Lmtd. Cat #842. (616) 964-6450 Gill’s Hematoxylin: See recipe. Eosin: 1x stock. Anatech Cat #837. Solutions (make fresh each day) Acid alcohol: 75% […]

View full entry

Tags: Fero-Histology


July 15, 2016

Necropsy Form

By UNM CCC UNM CCC

Necroscopy Notes Form

View full entry

Tags: Fero-Histology


July 15, 2016

Tissue Staining

By UNM CCC UNM CCC

Deparafinization The paraffin is removed from the section with xylene. If the tissues are to be stained with an aqueuous solution then the slides must rehydrated in graded ethanol baths. Unless a time is indicated the approach is to gently agitate the slides by repeated immersion ~20x in each bath: Procedure Xylene for 2 min. […]

View full entry

Tags: Fero-Histology


July 15, 2016

Tissue Processing and Sectioning

By UNM CCC UNM CCC

M. Fero 12.23.2011 Fixation The usual fixative for paraffin embedded tissues is neutral buffered formalin (NBF). 10% NBF contains 4% formaldehyde by weight and is therefore equivalent to 4% paraformaldehyde. NBF contains a pH buffer plus a preservative (methanol) which prevents the conversion of formaldehyde to formic acid. Because of the preservative, NBF has a […]

View full entry

Tags: Fero-Histology


July 15, 2016

Complete Mouse Necropsy

By UNM CCC UNM CCC

Euthanasia Euthanasia and mouse necropsies require prior IACUC approval. The mode of euthanasia should be chosen which minimizes pain or distress to the animal and provides biologically meaningful samples. Only personnel with appropriate animal training may handle live animals. Isoflourane inhalation: This should be given in sufficient dose to cause complete loss of breathing and […]

View full entry

Tags: Fero-Histology


July 15, 2016

Immunoflourescence of Cultured Cells

By UNM CCC UNM CCC

M. Fero — 3/13/98 Materials L-lysine coated glass cover slips or charged glass slides Neutral Buffered Formalin (Sigma HT50-128) 0.5% NP40 in PBS (2.5 N HCl or 0.07 N NaOH for BrDU staining only) Primary and secondary antibodies Vectashield (Vector Labs) Protocol Grow cells on L-lysine coated glass slips or cytospin cells onto charged glass […]

View full entry

Tags: Fero-Histology


July 5, 2016

Xenogen Imager

By UNM CCC UNM CCC

M. Fero 1/8/09 Procedure Register online Bring mouse in clean cage to imager Sign in on log sheet Clean inside of Xenogen system and external mouse anesthesia chamber. To minimize background, use black plastic background sheet for fluorescence, use black paper for luminescence. Anesthesia Turn on gas cylinder (but don’t change gas regulator on cylinder) […]

View full entry

Tags: Fero-Mice


July 5, 2016

Necropsy Form

By UNM CCC UNM CCC

Download the form for use.  

View full entry

Tags: Fero-Mice


July 5, 2016

Using the MPD

By UNM CCC UNM CCC

What is the MPD? The MPD is a laboratory relational database that allows users to cross-reference mouse inventory data, breeding records, pedigrees, pathology data, histology images, autoradiographs, PCR genotyping protocols, freezer archives, and reagents (specifically plasmids, oligonucleotides, and antibodies). It is comprised of a set of FileMaker templates which can be used on a single […]

View full entry

Tags: Fero-Mice


June 28, 2016

Tail DNA Preparation

By UNM CCC UNM CCC

(M.Fero 10/2013) Reagents Lysis Buffer: (10 mM Tris pH8, 100 mM NaCl, 25 mM EDTA, 0.5%SDS), store at room temp. 10 mg/mL Proteinase K: 100 mg (Roche) + 10 mL buffer (10 mM Tris pH8.0, 20 mM CaCl2, 50% (v/v) glycerol), store at -20ºC in 1.5 mL aliquots. Lysis buffer + proteinase K (1 mg/mL): […]

View full entry

Tags: Fero-Mice


June 28, 2016

Mouse p27 PCR Genotyping Using Gitschier Buffer

By UNM CCC UNM CCC

(PCR Recipe: Kogan et al, New Engl J Med 317: 985-990) Primer Sequences p27KO mice. JAX Stock 2781 (C57BL/6), JAX Stock 3122 (129S4) Fero ML, et al. Cell. (1996) 85:733-44 KO (knockout allele; Contains Neo) Neo-1 (CCTTCTATCGCCTTCTTG) K-3 (TGGAACCCTGTGCCATCTCTAT) Size: KO(-) = 0.5 kB WT (wildtype allele) K-3 (above) K-5 (GAGCAGACGCCCAAGAAGC) Size: WT(+) = 1 […]

View full entry

Tags: Fero-Mice