Items Tagged ‘Fero-Mice’

August 2, 2016

Mouse Toe Numbering Scheme


Download the diagram.

View full entry

Tags: Fero-Mice

July 5, 2016

Xenogen Imager


M. Fero 1/8/09 Procedure Register online Bring mouse in clean cage to imager Sign in on log sheet Clean inside of Xenogen system and external mouse anesthesia chamber. To minimize background, use black plastic background sheet for fluorescence, use black paper for luminescence. Anesthesia Turn on gas cylinder (but don’t change gas regulator on cylinder) […]

View full entry

Tags: Fero-Mice

July 5, 2016

Necropsy Form


Download the form for use.  

View full entry

Tags: Fero-Mice

July 5, 2016

Using the MPD


What is the MPD? The MPD is a laboratory relational database that allows users to cross-reference mouse inventory data, breeding records, pedigrees, pathology data, histology images, autoradiographs, PCR genotyping protocols, freezer archives, and reagents (specifically plasmids, oligonucleotides, and antibodies). It is comprised of a set of FileMaker templates which can be used on a single […]

View full entry

Tags: Fero-Mice

June 28, 2016

Tail DNA Preparation


(M.Fero 10/2013) Reagents Lysis Buffer: (10 mM Tris pH8, 100 mM NaCl, 25 mM EDTA, 0.5%SDS), store at room temp. 10 mg/mL Proteinase K: 100 mg (Roche) + 10 mL buffer (10 mM Tris pH8.0, 20 mM CaCl2, 50% (v/v) glycerol), store at -20ºC in 1.5 mL aliquots. Lysis buffer + proteinase K (1 mg/mL): […]

View full entry

Tags: Fero-Mice

June 28, 2016

Mouse p27 PCR Genotyping Using Gitschier Buffer


(PCR Recipe: Kogan et al, New Engl J Med 317: 985-990) Primer Sequences p27KO mice. JAX Stock 2781 (C57BL/6), JAX Stock 3122 (129S4) Fero ML, et al. Cell. (1996) 85:733-44 KO (knockout allele; Contains Neo) Neo-1 (CCTTCTATCGCCTTCTTG) K-3 (TGGAACCCTGTGCCATCTCTAT) Size: KO(-) = 0.5 kB WT (wildtype allele) K-3 (above) K-5 (GAGCAGACGCCCAAGAAGC) Size: WT(+) = 1 […]

View full entry

Tags: Fero-Mice

June 28, 2016

Mouse Compete Blood Counts


M. Fero — 4/11/00, updated 4/25/03 Materials Plastic tubes with anticoagulant: PBS + 2 µL anticoagulant for each 100 µL blood to be collected Anticoagulant: 10% Na2EDTA, pH=7.4. 250 µL of fresh mouse blood in plastic tubes containing EDTA. RBC lysis buffer (388 mM NH4Cl, 29.7 mM NaHCO3, 25 µM Na2EDTA) 20.75 g. NH4Cl 2.5 […]

View full entry

Tags: Fero-Mice